Molecular Basis of Inheritance

A transcription unit in DNA is defined primarily by three regions: a promoter, the structural gene and a terminator. The promoter lies towards the upstream (5') end of the structural gene and the terminator towards the downstream (3') end.

In the lac operon, the y gene codes for permease. Permease increases the permeability of the cell to lactose, i.e. it transports lactose into the bacterial cell. ($\beta$-galactosidase hydrolyses lactose into glucose and galactose, and transacetylase is coded by the a gene.)

Frederick Griffith – transformation Francois Jacob & Jacques Monod – lac operon Har Gobind Khorana – genetic code Meselson & Stahl – semi-conservative mode of DNA replication Correct match: A-III, B-IV, C-I, D-II.

DNA-dependent DNA polymerase catalyses polymerisation only in one direction, $5' \rightarrow 3'$. It adds nucleotides to the free 3'-OH end of the growing strand, which is why replication is continuous on one strand and discontinuous on the other.

The template strand has polarity $3' \rightarrow 5'$; RNA is synthesised complementary to it in the $5' \rightarrow 3'$ direction, with uracil in place of thymine. Template: $3'$ TACATGGCAAATATCCATTCA $5'$ Product: $5'$ AUGUACCGUUUAUAGGUAAGU $3'$

RNA polymerase III – transcribes tRNA, 5S rRNA and snRNAs Termination of transcription – Rho factor Splicing of exons – snRNPs TATA box – promoter region Correct match: A-IV, B-III, C-I, D-II.