Looking for classes? Ksquare Career Institute, Bengaluru →
Molecular Basis of Inheritance
Transcription - Template and mRNA Strand
1 question from 1 paper, each with its answer.
- question
- 1
- paper
- 1
- years asked, 2017–2026
- 1 of 10
- of Molecular Basis of Inheritance
- 0.5%
Concepts tested
- Writing the complementary RNA transcript from a DNA template
All Questions
2024 1 question
-
Which one is the correct product of DNA dependent RNA polymerase to the given template? $3'\ TACATGGCAAATATCCATTCA\ 5'$The template strand has polarity $3' \rightarrow 5'$; RNA is synthesised complementary to it in the $5' \rightarrow 3'$ direction, with uracil in place of thymine. Template: $3'$ TACATGGCAAATATCCATTCA $5'$ Product: $5'$ AUGUACCGUUUAUAGGUAAGU $3'$